I translated this code to " At eat unusual animals because hungry students are special" Im guessing thats not what it is supposed to say but that is the code I got.
I'm sorry that's incorrect. The correct sentence is "The class was at school to learn anthropology." I also made a mistake in the sentence. Just remember when you decode a DNA strand, T becomes A, A become U and C becomes G or G becomes C. And in my sentence you start where a start is placed and the first two words weren't sprt of the sentence! Good try though! It's very confusing!
Amanda (Pomish), take some time to review the protein synthesis process. Normally, when students have difficulty figuring out the sentence, it is because they start right at the beginning instead of after the start codon, but that doesn't seem to be the case here as you would have then said the first word was "time" (AUA). Make sure you have done the transcription first (Amanda H. has given good guidance there). Then look for the start codons and go from there.
Amanda H. - Good code but the uracil that snuck in there messed things up. As a result, I coded "skull" instead of "school", since the U replaces the T so I transcribed it to "A". It should have been a C if you were trying to code for "school". Otherwise, good code.
Here is my decode for reference: DNA: TATATTTACACCTCTGATCCATGUAACGCATTGATC RNA: AUAUAAAUGUGGAGACUAGGUACAUUGCGUAACUAG AUG UGG AGA CUA GGU ACA UUG CGU AAC UAG (start) The class was at skull(s) to learn anthropology. (stop)
I translated this code to " At eat unusual animals because hungry students are special" Im guessing thats not what it is supposed to say but that is the code I got.
ReplyDeleteI'm sorry that's incorrect. The correct sentence is "The class was at school to learn anthropology." I also made a mistake in the sentence. Just remember when you decode a DNA strand, T becomes A, A become U and C becomes G or G becomes C. And in my sentence you start where a start is placed and the first two words weren't sprt of the sentence! Good try though! It's very confusing!
ReplyDelete
ReplyDeleteAmanda (Pomish), take some time to review the protein synthesis process. Normally, when students have difficulty figuring out the sentence, it is because they start right at the beginning instead of after the start codon, but that doesn't seem to be the case here as you would have then said the first word was "time" (AUA). Make sure you have done the transcription first (Amanda H. has given good guidance there). Then look for the start codons and go from there.
Amanda H. - Good code but the uracil that snuck in there messed things up. As a result, I coded "skull" instead of "school", since the U replaces the T so I transcribed it to "A". It should have been a C if you were trying to code for "school". Otherwise, good code.
Here is my decode for reference:
DNA: TATATTTACACCTCTGATCCATGUAACGCATTGATC
RNA: AUAUAAAUGUGGAGACUAGGUACAUUGCGUAACUAG
AUG UGG AGA CUA GGU ACA UUG CGU AAC UAG
(start) The class was at skull(s) to learn anthropology. (stop)